+206-522-5432

IEH SARS-CoV-2 RT-PCR Kit Validation Information

This in vitro diagnostic test is pending FDA review under the EUA program.

Summary of validation information for IEH SARS-CoV-2 RT-PCR Test:

Assay sensitivity: Limit of detection studies.

Limit of Detection (LoD) studies determine the lowest detectable concentration of SARS-CoV-2 at which approximately 95% of all (true positive) replicates would test positive. To determine LoD values for the N1 and N2 RT-PCR assays, tests were performed in a Stratagene MX-3005P with RNA extracted from heat inactivated SARS-CoV-2 (Catalog # NR-52286. Lot# 70033548). Covid-19 negative clinical matrix, composed of swabs transported in IEH viral transport media (IEH VTM), were spiked with the virus, and RNA was extracted in a Thermofisher Kingfisher platform using the IEH nucleic acid extraction reagent kit. LoD for both N1 and N2 were 2000 Genome copies per ml (or 10 genome copies per reaction).

  N1 Target N2 Target
 Genome copies/ reaction 2.5 GEC/Rx 5 GEC/Rx 10GE/Rx 2.5 GEC/Rx 5 GEC/Rx 10GE/Rx
LoD # 0.25X 0.5X 1X 0.25X 0.5X 1X
Genome copies per ml 500 1000 2000 500 1000 2000
Positive/Total 20/24 20/24 24/24 19/24 18/24 24/24
Mean 35.20 34.37 35.26 37.29 37.01 34.55
Std Dev 1.14 1.35 0.73 1.02 1.07 0.70

Bridging studies to validate positive clinical specimens transported in non IEH VTM:

To determine the LoD of specimens that are transported in non-IEH VTM systems, pooled negative clinical matrix obtained from the Washington State Public Health Laboratories (PHL) was spiked with the heat inactivated SARS-CoV-2 (BEI Catalog # NR-52286. Lot# 70033548). Purification was done as describe previously. The LoD values were 2000GEC/ml for the N2 target and 4000 GEC/ml for the N1 target.

  N1 target: WA State PHL Panel N2 target: WA State PHL Panel
 Genome copies/ reaction 5GEC/Rx 10GEC/Rx 20GEC/Rx 30GEC/Rx 5GEC/Rx 10GEC/Rx 20GEC/Rx 30GEC/Rx
LoD # 0.25X 0.5X 1X 1.5X 0.5X 1X 2X 3X
Genome copies per ml 1000 2000 4000 6000 1000 2000 4000 6000
Positive/Total 9/24 17/24 24/24 24/24 8/24 24/24 24/24 24/24
Mean 35.42 35.08 34.61 33.79 36.15 34.62 33.57 32.92
Std Dev 1.73 0.67 0.75 1.30 1.10 0.84 0.59 0.43

Bridging studies to validate LoD for assays done using spin columns.

To determine the equivalent LoD of the RT-PCR assay performed on specimens purified using spin columns compared to that from Kingfisher based purification, IEH VTM based negative clinical matrix were spiked with the heat inactivated virus. The bridging LoD were 3000 genome copies/ ml for the N1 target and 4000 genome copies/ ml for the N2 target. These two values are within the required <3X LoD values of the Kingfisher purification.

N1 Assay: Spin Columns N2 Assay: Spin Columns
Genome copies/ reaction 15GEC/Rx 20GEC/Rx 40GEC/Rx 15GEC/Rx 20GEC/Rx 40GEC/Rx
Genome copies/ ml 3000 4000 8000 3000 4000 8000
Positive/Total 24/24 24/24 24/24 22/24 23/24 24/24
Mean 36.24 35.54 34.21 34.76 34.45 33.78
Std Dev 1.028 0.889 0.471 0.547 0.741 0.598

Inclusivity:

Primers and probes were analyzed using the NCBI Primer-BLAST tool, as well as a ‘Virtual PCR’ utility developed in-house at IEH. Probes were also verified by treating them as forward primers and pairing them with the matching reverse primer. Using both algorithms, primers listed in the table 2 matched with 100% sequence identity to all the sequenced SARS-CoV-2 genomes. N1 primer probe set did not have any mismatches. The 5’ of the N2 probe had a one mismatch.

N1 amplicon consensus sequence from 8250 NCBI SARS2 sequences, with forward/reverse primers & probe:

GACCCCAAAATCAGCGAAATGCACCCCGCATTACGTTTGGTGGACCCTCAGATTCAACTGGCAGTAACCAGA

GACCCCAAAATCAGCGAAAT  ACCCCGCATTACGTTTGGTGGACC  CAGATTCAACTGGCAGTAACCAGA

********************  ************************  ************************

N2 amplicon consensus sequence from 8250 NCBI SARS2 sequences, with forward/reverse primers & probe:

TTACAAACATTGGCCGCAAATTGYWCAATTTGCCCCCAGCGCTTCAGCGTTCTTCGGAATGTCGCGC

TTACAAACATTGGCCGCAAA    ACAATTTGCCCCCAGCGCTTCAG  TTCTTCGGAATGTCGCGC

********************     **********************  ******************

This SNP, found 43 genomes, would not significantly affect the performance of the assay given their relative obscurity of the SNP and location within the probe. The exonuclease activity of Taq DNA Polymerase should not be affected by the displaced 5’ base and the attached fluorophore.

Cross reactivity:

Primers and probes were analyzed using the NCBI Primer-BLAST tool as well as a ‘Virtual PCR’ utility developed in-house at IEH against the pathogens that are normally encounter in human respiratory tract. Primer-BLAST was utilized by specifying each forward & reverse primer set individually to search for possible off-targets in the ‘nr’ (non-redundant) NCBI nucleotide database, not filtered by organism to search the entire database. Primer-BLAST showed no off-targets. The Virtual PCR utility also showed no off-targets. This utility used the latest bacterial and viral genomes downloaded from NCBI, including all NCBI COVID-19 sequences and other Coronavirus variants (229E, OC43, HKU1, NL63, the original SARS, and MERS, among others). Probes were also verified by treating them as forward primers and pairing them with the matching reverse primer. Primers were not wet tested.